MarketAlternative flatworm mitochondrial code
Company Profile

Alternative flatworm mitochondrial code

The alternative flatworm mitochondrial code is a genetic code found in the mitochondria of Platyhelminthes and Nematodes.

Code
:   AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNNKSSSSVVVVAAAADDEEGGGG :Starts = -----------------------------------M---------------------------- : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V) ==Differences from the standard code==
Differences from the standard code
==Systematic range and comments==
Systematic range and comments
Platyhelminthes (flatworms) and Nematoda (roundworms). Code 14 differs from code 9 (the echinoderm and flatworm mitochondrial code) only by translating UAA to Tyr rather than STOP. A study in 2000 has found no evidence that the codon UAA codes for Tyr in the flatworms but other opinions exist. There are very few GenBank records that are translated with code 14 but a test translation shows that re-translating these records with code 9 can cause premature terminations. More recently, UAA has been found to code for tyrosine in the nematodes Radopholus similis and Radopholus arabocoffeae. ==See also==
tickerdossier.comtickerdossier.substack.com