MarketBlastocrithidia nuclear code
Company Profile

Blastocrithidia nuclear code

The Blastocrithidia nuclear code is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia. This code, along with translation tables 27 and 28, is remarkable in that every one of the 64 possible codons can be a sense codon.

The code (31)
:   AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG :Starts = ----------**-----------------------M---------------------------- : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V). ==Differences from the standard code==
tickerdossier.comtickerdossier.substack.com