MarketCephalodiscidae mitochondrial code
Company Profile

Cephalodiscidae mitochondrial code

The Cephalodiscidae mitochondrial code is a genetic code used by the mitochondrial genome of Cephalodiscidae (Pterobranchia). The Pterobranchia are one of the two groups in the Hemichordata which together with the Echinodermata and Chordata form the major clades of deuterostomes.

The code
:   AAs = FFLLSSSSYYY*CCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSSKVVVVAAAADDEEGGGG :Starts = ---M-------*-------M---------------M---------------M------------ : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V). == Differences from the standard code ==
tickerdossier.comtickerdossier.substack.com