Invertebrate mitochondrial code

:   AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSSSVVVVAAAADDEEGGGG :Starts = ---M----------------------------MMMM---------------M------------ : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V). ==Differences from the standard code==

Note: The codon AGG is absent in Drosophila. Alternative initiation codons • ATA/AUA • ATT/AUU • ATC/AUC: Apis • GTG/GUG: Polyplacophora • TTG/UUG: Ascaris, Caenorhabditis. ==Systematic range==

• Nematoda: Ascaris, Caenorhabditis; • Mollusca: Bivalvia); Polyplacophora; • Arthropoda/Insecta: Drosophila [Locusta migratoria (migratory locust), Apis mellifera (honeybee)]. ==Other variations==

• Several arthropods translate the codon AGG as lysine instead of serine (as in the Pterobranchia Mitochondrial Code) or arginine (as in the standard genetic code). • GUG may possibly function as an initiator in Drosophila. AUU is not used as an initiator in Mytilus and D. yakuba, since its only plausible initiation codon, AUA, is out of frame with the rest of the gene. Initiation appears to require the "reading" of an AUAA quadruplet, which would be equivalent to initiation at AUA followed immediately by a specific ribosomal frameshift. Another possible mechanism ... is that the mRNA is "edited" to bring the AUA initiation into frame." == See also ==